Archives

CBSE 12th Board Biology Expected Questions 2014

Many of the students from class 12th have urged to us to provide sample paper on Biology and based on the their request here we are providing some of the most important questions of Biology which are most expected to be encountered in the CBSE class 12th board examinations. The questions have been selected from previous year papers and most expected topics for session 2013-14.

Students who are going to appear in the class 12th board examinations this year have the most common problem of lagging preparations in Biology. As the board exams are on head and it is not possible for the students to cover the maximum portion of subject it is advisable to solve as many expected and important questions on the subject which carry highest probability to hit in the board exams.

The questions which we are providing here are specially designed and selected for the students to increase their chance of high scores in the subject which is usually considered as a tough subject to the students. Check it below.

CBSE 12th Board Biology Syllabus

First of all the necessary prerequisite for the students to score high in the board exams is to know their syllabus and the mark they carry in the final exams as clear as water.

Following are the units from which the questions are to come in the board exams. Corresponding weightage of marks which each of the unit carry has been mentioned ahead of the unit.

Reproduction – 14 Marks

Genetics & Evolution – 18 Marks

Biology & Human Welfare – 14 Marks

Biotechnology & its Applications – 10 Marks

Ecology & Environment – 14 Marks

Total marks is 70. Now it is up to the students planning that how the time is divided between different subjects.

CBSE 12th Board Biology Important Questions

1)    A woman has conceived and implantation has occurred in her uterus. Explain the sequence of changes up to Parturition which takes place within her body.

2)    With an example, explain how Bio technology has been applied in each of the following:

a)    In curing Diabetes mellitus

b)    In raising pest resistant plants

c)     In producing more nutritionally balanced milk.

Do you think it is ethical to manipulate organisms for human benefits? Justify your answer.

3)    A) Give reasons for

i)   Both strands of DNA re not copied during transcription.

ii) Transcription and Translation in bacteria can be coupled.

B) Name the regions of a transcript unit.

C) Differentiate between the process of Transcription in prokaryotes and eukaryotes.

4) Explain the basis on which the gel electrophoresis technique works. Write any two ways the products obtained through this technique can be applied.

5)   A) Explain the process of microsporogenesis in angiosperms.

B) Explain the triple fusion in angiosperm.

6) How is the “sixth episode of extinction” of specie on earth, now currently in progress, different from five earlier episodes? What is it due to? Explain the various causes that have brought about this difference.

7)  A) Draw the embryo sac of a flowering plant and label

I) Central cell

II) Chalazal end of the embryo sac

III) Synergids

B) Name the cell that develops into the embryo sac and explain how this cell leads to the formation of embryo sac.

8) Given below are the sequence of nucleotides in a particular m- RNA and amino acids coded by it:

UUUAUGUUCGAGUUAGUGUAA

Phe – met – phe – glu – leu – val

Write the properties of genetic code that can be and that cannot be correlated from the above given data.

These were the 8 important questions on Biology for CBSE 12th board. Practice it well and maximise your probability for high scores.

Click here for Biology SET A Question paper 2013-14

We will be providing more study material based on the students request which we get. So keep asking us for your doubts and we shall feel obliged to answer you.

Stay with us for more information on CBSE Board exams 2014. Like us on Facebook as CBSE EXAM Result to get updates on your wall.